Files
2021-04-15 13:31:59 -05:00

98 lines
5.5 KiB
Plaintext

[--------------------------------------------------------------------------]
ooooo ooooo .oooooo. oooooooooooo HOE E'ZINE RELEASE #580
`888' `888' d8P' `Y8b `888' `8
888 888 888 888 888 "DNA, The Perfect Template
888ooooo888 888 888 888oooo8 for a Metaphor"
888 888 888 888 888 "
888 888 `88b d88' 888 o by Anilos [4/14/99]
o888o o888o `Y8bood8P' o888ooooood8
[--------------------------------------------------------------------------]
Over my spring break I learned a lot of different things, but more
important of all is the epiphany I had one night in the vector of
inspiration for me, the garage. I'm fairly certain now that Molecular
Biology can be a metaphor for just about anything in life, allow me to
elucdicate... DNA, the little molecule that is the blueprints for our
entire body is essentially a message, a story, if you will. Before I
continue I just would like to apologize to the people reading this and not
understanding a damn thing, I just feel I should write about this since I
find it fascinating. There is a lot about DNA that would take up pages and
pages of explanation, but I'm trying to appeal to all people here so I'll
try to make it short and simple.
DNA is two nucleotides wound together in the double helix I'm sure
everyone has heard at least once (i.e. Those who have seen Jurassic park,
more than likely). The "rungs" on the DNA "Ladder" are essentially
nitrogen bases We won't refer to them by their technical names and instead
as A,T,G, and C. Now then, In DNA the A's must pair with a T and the G's
must pair with a C and vice versa (T to A and C to G). If your still with
me, pat yourself on the back, I don't plan on putting in any references to
sex, gatorade or rage (which is going to be really hard for me). So, if
your looking for any of the aforementioned, just stop. I'm sitting in my
garage now and I was thinking about the days lesson in Molecular biology...
Mutations. I began to think, "Hmm, now, mutations can be beneficial or
harmful. And DNA itself is a message which might very well decide
important aspects of our lives, therefore we can use DNA as a metaphor for
life! Yes! This will probably bore some people, but goddamnit, I don't
care."
Let's write out a basic DNA 'Message':
(I'm going to use an acquaintence's name as an example, and because
it's already written down on paper and I don't want to use mine, it would
take too long.)
ACATTGTTTTTTGATCGGTTCTGGTTATTCTAGTAGGATCGCCCGTTTTTGCCACCA
- Now, believe it or not, this in fact actually spells out my
acquaintence's name "Matt Eric Biggerstaff" (The translation of
the message isn't important nor relevant to the point of this, but
hell, if your interested anyways just e-mail me). Basically, this
is a normal, happy little piece of DNA. Mutations, though can
screw the message up, so we can assume, that if life was a DNA
strand, mutations could screw up someone's life. Let us look at
some common mutations and practical applications to this
metaphorical look at DNA:
- Substitution: This is where one of the four letters (A,T,C, and
G) are mispaired (ie. A to G or T to C).
An example for life: Instead of your real dad, your mom
re-marries and substitutes a step-dad, potentiality for a screw
up/misreading of the DNA.
- Insertion: DNA is read in tripletts (GAT, TTT, etc.) but with
insertion you end up with sequences such as, GATA, TTT, etc.
Another example for life: I began to date a very odd girl that
only made my life miserable, essentially she was "inserted" into
my life (I know some of you are giggling at the word 'insert').
- Deletion: When being read in tripletts, this is when a A,C,G or
T is missing (i.e. the small message above, GAT, TTT may become
GA, TTT).
My example for life using someone I'm sure everyone has heard me
bitch about: I dated this really nice girl, the most wonderful
and best thing I've ever had in my fairly lonely and boring life.
But I broke up with her because of reasons I even don't know, she
was "deleted" from my life and of course everything went screwy.
Many of you are probably thinking now, "But, mistakes can't screw up
someone's entire life, your wrong in your comparison of DNA mutations to
everyday life". True, you are very sharp indeed if you thought that. But
alas, I'm not finished quite yet. Sure, one mistake obviously isn't going
to screw over your entire life like a mutation can do in a human's DNA.
But, there is a repair 'tool' you might say that exists in DNA. This
veritable repair utility finds mutations and fixes them before they can
cause any significant damage. I'm right, and your wrong. Whee, I love
being in control somewhat. I hope this made at least a small amount of
sense, if it didn't just tell me. I'll more than likely ignore you, but
hey at least you tried! Or you can always deflate my ego by sending me a
message pointing out mistakes. Either way, I'll write something more
appealing to the masses next time, but for now I'm on spring break -- thank
God -- and I feel like indulging in what I want.
[--------------------------------------------------------------------------]
[ (c) !LA HOE REVOLUCION PRESS! HOE #580 - WRITTEN BY: ANILOS - 4/14/99 ]